The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-140-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cagugguuuuacccuaugguag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-140-5p inhibits HCC by directly targeting PIN1 to block multiple cancer-driving pathways. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
2 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Adenosine deaminase (ADA)
|
Target Info
|
|
Aspartyl aminopeptidase (DNPEP)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-200b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaauacugccugguaaugauga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miRNA-200b regulates PIN1 expression at the translational level by targeting its 3' UTR. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
CDK inhibitor 1B p27Kip1 (CDKN1B)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-200c-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaauacugccggguaaugaugga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR200c suppressed the luciferase activity of the vector with wild-type PIN1 3'UTR, whereas mutation of miR200c seed region in PIN1 3'UTR abolished the regulating effects of miR200c on PIN1 3'UTR. |
[4] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Activin receptor type IIB (ACVR2B)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-296-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agggcccccccucaauccugu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[5] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-874-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cugcccuggcccgagggaccga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-874-3p plays a tumour suppressive role in HCC through down-regulation of PIN1. |
[6] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
Cyclin-dependent kinase 9 (CDK9)
|
Target Info
|
|
Histone deacetylase 1 (HDAC1)
|
Target Info
|
|