The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-125a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucccugagacccuuuaaccuguga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
ELISA |
[1] |
2 |
qRT-PCR |
[2] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator BAK (BAK)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-98-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagguaguaaguuguauuguu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-98 in reduction of endothelial inflammation via direct targeting of pro-inflammatory mediators, such as CCL5. |
[3] |
Evidence Score (E-score) |
2 |
+ |
1 |
ELISA |
[1] |
2 |
ELISA; Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Aromatase (CYP19A1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-146a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagaacugaauuccauggguu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[4] |
Representative Target(s) Regulated by This miRNA |
Activation B7-1 antigen (CD80)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-214-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acagcaggcacagacaggcagu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The most highly upregulated chemokine, CCL5, (C-C motif ligand 5) is found to be a direct target of miR-214. |
[5] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay |
[5] |
Representative Target(s) Regulated by This miRNA |
Activating transcription factor 4 (ATF-4)
|
Target Info
|
|
ADP-ribosylation factor-like protein 2 (ARL2)
|
Target Info
|
|
miRNA Mature ID |
hsa-let-7g-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cuguacaggccacugccuugc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Let-7g-3p reduces endothelial inflammation via direct targeting of pro-inflammatory mediators CCL5. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Cardiac myosin (MYBPC3)
|
Target Info
|
|
Monocyte chemotactic and activating factor (CCL2)
|
Target Info
|
|