Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T15048 Target Info
Target Name Insulin-like growth factor-binding protein 1 (IGFBP1)
Synonyms Placental protein 12; PP12; KITLG; IGFBP-1; IGF-binding protein 1; IBP1; IBP-1
Target Type Literature-reported Target
Gene Name IGFBP1
Biochemical Class Insulin-like growth factor binding
UniProt ID
P08833
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-29c leads to a blunted decidualization response as measured by IGF binding protein (IGFBP)-1 expression levels. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-542-3p miRNA Info
miRNA Mature AC
MIMAT0003389
Sequence ugugacagauugauaacugaaa
miRNA Species Homo sapiens
Regulation Mechanism 3'UTR of IGFBP1 mRNA is targeted by miR-542-3p. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Angiopoietin-2 (ANGPT2) Target Info
ANGP2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
References  Top
REF 1 Functional microRNA involved in endometriosis. Mol Endocrinol. 2011 May;25(5):821-32.
REF 2 Loss of miR-542-3p enhances IGFBP-1 expression in decidualizing human endometrial stromal cells. Sci Rep. 2017 Jan 4;7:40001.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.