Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T13852 Target Info
Target Name Sphingosine-1-phosphate receptor 1 (S1PR1)
Synonyms Sphingosine 1-phosphate receptor Edg-1; S1P1; S1P receptor Edg-1; S1P receptor 1; Endothelial differentiation G-protein coupled receptor 1; CHEDG1; CD363
Target Type Successful Target
Gene Name S1PR1
Biochemical Class GPCR rhodopsin
UniProt ID
P21453
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism The luciferase activity was significantly reduced in HepG2 cells cotransfected with the wild type 3'UTR of S1PR1 and miR 48a mimics, but unchanged in HepG2 cells cotransfected with the mutant S1PR1 3 UTR and miR-48a mimics, indicating that miR-48a directly binds to the 3'UTR of S1PR1 in HepG2 cells. [3]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-363-3p miRNA Info
miRNA Mature AC
MIMAT0000707
Sequence aauugcacgguauccaucugua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-125b-1-3p miRNA Info
miRNA Mature AC
MIMAT0004592
Sequence acggguuaggcucuugggagcu
miRNA Species Homo sapiens
Regulation Mechanism miR-125b-1-3p mimics significantly reduced the relative luciferase activity of the pmir-S1PR1 vector compared with the scramble control but did not affect the luciferase activity of the pmir-S1PR1-M vector demonstrating that S1PR1 could be directly targeted by miR-125b-1-3p in human placenta. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
ERK activator kinase 7 (MAP2K7) Target Info
MP2K7_HUMAN
References  Top
REF 1 microRNA-148a dysregulation discriminates poor prognosis of hepatocellular carcinoma in association with USP4 overexpression. Oncotarget. 2014 May 15;5(9):2792-806.
REF 2 MicroRNA-148a inhibits migration and invasion of ovarian cancer cells via targeting sphingosine-1-phosphate receptor 1. Mol Med Rep. 2015 Sep;12(3):3775-3780.
REF 3 microRNA-148a inhibits hepatocellular carcinoma cell invasion by targeting sphingosine-1-phosphate receptor 1. Exp Ther Med. 2015 Feb;9(2):579-584.
REF 4 MicroRNA-363-mediated downregulation of S1PR1 suppresses the proliferation of hepatocellular carcinoma cells. Cell Signal. 2014 Jun;26(6):1347-54.
REF 5 miR-125b-1-3p inhibits trophoblast cell invasion by targeting sphingosine-1-phosphate receptor 1 in preeclampsia. Biochem Biophys Res Commun. 2014 Oct 10;453(1):57-63.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.