Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T13075 |
Target Info
|
| Target Name |
Casein kinase I alpha (CSNK1A1) |
| Synonyms |
Casein kinase I isoform alpha; CKI-alpha; CK1 |
| Target Type |
Clinical trial Target |
| Gene Name |
CSNK1A1 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-155-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuaaugcuaaucgugauagggguu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Casein kinase 1 a (CK1a ) is a novel miR-155 target. |
[2] |
| Evidence Score (E-score) |
3 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Proteomics |
[2] |
| 3 |
Reporter Assay |
[3] |
| Representative Target(s) Regulated by This miRNA |
Acetyl-CoA transporter (SLC33A1)
|
Target Info
|
|
|
Angiotensin II receptor type-1 (AGTR1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-155 is a liposarcoma oncogene that targets casein kinase-1 and enhances -catenin signaling. Cancer Res. 2012 Apr 1;72(7):1751-62.
|
| REF 2 |
Widespread changes in protein synthesis induced by microRNAs.Nature. 2008 Sep 4;455(7209):58-63.
|
| REF 3 |
Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
