The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-206 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggaauguaaggaagugugugg
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
ELISA; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
2 |
PAR-CLIP |
[2] |
Representative Target(s) Regulated by This miRNA |
Annexin A2 (ANXA2)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-495-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaacaaacauggugcacuucuu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-495 mimics significantly inhibited the luciferase activity of CCL2-3'UTR vector and this inhibitory effect was absent in the mutated vector and miR-495 target protector group indicating that miR-495 could bind to the 3'UTR of CCL2 in HEK293FT cells. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Endoplasmic reticulum chaperone BiP (HSPA5)
|
Target Info
|
|
Forkhead box protein C1 (FOXC1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-98-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugagguaguaaguuguauuguu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-98 in reduction of endothelial inflammation via direct targeting of pro-inflammatory mediators, such as CCL2. |
[4] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Aromatase (CYP19A1)
|
Target Info
|
|
miRNA Mature ID |
hsa-let-7g-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cuguacaggccacugccuugc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Let-7g-3p, in reduction of endothelial inflammation via direct targeting of pro-inflammatory mediators such as CCL2. |
[4] |
Evidence Score (E-score) |
1 |
+ |
1 |
ELISA; Luciferase Reporter Assay; Western Blot |
[4] |
Representative Target(s) Regulated by This miRNA |
Cardiac myosin (MYBPC3)
|
Target Info
|
|
Monocyte chemotactic and activating factor (CCL2)
|
Target Info
|
|