Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T09185 | Target Info | |||
| Target Name | Epithelial discoidin domain receptor 1 (DDR1) | ||||
| Synonyms | Tyrosine-protein kinase CAK; Tyrosine kinase DDR; TRKE; TRK E; RTK6; Protein-tyrosine kinase RTK-6; Protein-tyrosine kinase 3A; PTK3A; NTRK4; NEP; Mammary carcinoma kinase 10; MCK-10; HGK2; Epithelial discoidin domain-containing receptor 1; EDDR1; Discoidin receptor tyrosine kinase; Cell adhesion kinase; CD167a; CD167 antigen-like family member A | ||||
| Target Type | Patented-recorded Target | ||||
| Gene Name | DDR1 | ||||
| Biochemical Class | Kinase | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-199b-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | cccaguguuuagacuaucuguuc | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | miR-199b-5p specifically targets DDR1 via its binding sites in 3'UTR. | [1] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Immunohistochemistry; Luciferase Reporter Assay; Northern Blot; Western Blot | [1] | |||
| 2 | Luciferase Reporter Assay; Western Blot; RT-PCR | [2] | |||
| Representative Target(s) Regulated by This miRNA | Epithelial discoidin domain receptor 1 (DDR1) | Target Info | |||
| Erbb2 tyrosine kinase receptor (HER2) | Target Info | ||||
| miRNA Mature ID | hsa-let-7g-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | ugagguaguaguuuguacaguu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | Let-7g significant repressed the activation of DDR indirectly. | [3] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [3] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-xL (BCL-xL) | Target Info | |||
| Caspase-3 (CASP3) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | miR-199b-5p directly targets PODXL and DDR1 and decreased levels of miR-199b-5p correlate with elevated expressions of PODXL and DDR1 in acute myeloid leukemia. Am J Hematol. 2012 Apr;87(4):442-6. | ||||
| REF 2 | MiR-199a/b-5p Inhibits Lymphangiogenesis by Targeting Discoidin Domain Receptor 1 in Corneal Injury. Mol Cells. 2018 Feb 28;41(2):93-102. | ||||
| REF 3 | Hsa-let-7g miRNA regulates the anti-tumor effects of gastric cancer cells under oxidative stress through the expression of DDR genes. J Toxicol Sci. 2015 Jun;40(3):329-38. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.