Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T08856 Target Info
Target Name Matrix metalloproteinase-8 (MMP-8)
Synonyms PMNL-CL; PMNL collagenase; Neutrophil collagenase; CLG1
Target Type Clinical trial Target
Gene Name MMP8
Biochemical Class Peptidase
UniProt ID
P22894
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-539-5p miRNA Info
miRNA Mature AC
MIMAT0003163
Sequence ggagaaauuauccuuggugugu
miRNA Species Homo sapiens
Regulation Mechanism miR-539 had an obvious effect of inhibiting the luciferase intensity of wild-type 3'UTR luciferase reporter, but the inhibitory effect of miR-539 was reduced in the presence of mutant 3'UTR luciferase reporter. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Matrix metalloproteinase-8 (MMP-8) Target Info
MMP8_HUMAN
References  Top
REF 1 MicroRNA-539 suppresses osteosarcoma cell invasion and migration in vitro and targeting Matrix metallopeptidase-8. Int J Clin Exp Pathol. 2015 Jul 1;8(7):8075-82.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.