Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T08123 Target Info
Target Name Leucine-rich repeat kinase 2 (LRRK2)
Synonyms PARK8; Leucine-rich repeat serine/threonine-protein kinase 2; Dardarin
Target Type Clinical trial Target
Gene Name LRRK2
Biochemical Class Kinase
UniProt ID
Q5S007
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Regulation Mechanism These results demonstrate that miR-205 suppresses the expression of LRRK2 protein through the direct targeting the 3'UTR of LRRK2. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-582-5p miRNA Info
miRNA Mature AC
MIMAT0003247
Sequence uuacaguuguucaaccaguuacu
miRNA Species Homo sapiens
Regulation Mechanism miR-582-5p suppressed the expression of target gene leucine-rich repeat kinase 2 (LRRK2). [3]
Evidence Score (E-score) 1 +
1 qRT-PCR [3]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
Caspase-9 (CASP9) Target Info
CASP9_HUMAN
miRNA Mature ID hsa-miR-582-3p miRNA Info
miRNA Mature AC
MIMAT0004797
Sequence uaacugguugaacaacugaacc
miRNA Species Homo sapiens
Regulation Mechanism miR-582-3p suppressed the expression of target gene leucine-rich repeat kinase 2 (LRRK2). [3]
Evidence Score (E-score) 1 +
1 qRT-PCR [3]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
Geranylgeranyl transferase I (GGTase-I) Target Info
PGTB1_HUMAN
References  Top
REF 1 MicroRNA-205 regulates the expression of Parkinson's disease-related leucine-rich repeat kinase 2 protein. Hum Mol Genet. 2013 Feb 1;22(3):608-20.
REF 2 A Proteomics Approach to Investigate miR-153-3p and miR-205-5p Targets in Neuroblastoma Cells.PLoS One. 2015 Dec 3;10(12):e0143969.
REF 3 Therapeutic effects of microRNA-582-5p and -3p on the inhibition of bladder cancer progression. Mol Ther. 2013 Mar;21(3):610-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.