Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T07087 Target Info
Target Name Focal adhesion kinase 2 (PTK2B)
Synonyms Related adhesion focal tyrosine kinase; RAFTK; Protein-tyrosine kinase 2-beta; Proline-rich tyrosine kinase 2; PYK2; FAK2; FADK 2; Cell adhesion kinase beta; Calcium-regulated non-receptor proline-rich tyrosine kinase; Calcium-dependent tyrosine kinase; CAKB; CAK-beta; CADTK
Target Type Literature-reported Target
Gene Name PTK2B
Biochemical Class Kinase
UniProt ID
Q14289
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuaccac
miRNA Species Homo sapiens
Regulation Mechanism Pyk2 is a target of miR-23b in glioma cells. [1]
Evidence Score (E-score) 2 +
1 Immunoblot [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
miRNA Mature ID hsa-miR-517a-3p miRNA Info
miRNA Mature AC
MIMAT0002852
Sequence aucgugcaucccuuuagagugu
miRNA Species Homo sapiens
Regulation Mechanism miR-517a directly regulates PTK2B expression through specific binding to the 3'UTR and cleaving its mRNA. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Focal adhesion kinase 2 (PTK2B) Target Info
FAK2_HUMAN
miRNA Mature ID hsa-miR-517c-3p miRNA Info
miRNA Mature AC
MIMAT0002866
Sequence aucgugcauccuuuuagagugu
miRNA Species Homo sapiens
Regulation Mechanism miR-517c directly regulates PTK2B expression through specific binding to the 3'UTR and cleaving its mRNA. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Focal adhesion kinase 2 (PTK2B) Target Info
FAK2_HUMAN
References  Top
REF 1 miRNA expression profiling in migrating glioblastoma cells: regulation of cell migration and invasion by miR-23b via targeting of Pyk2. PLoS One. 2012;7(6):e39818.
REF 2 microRNA-23b suppresses epithelial-mesenchymal transition (EMT) and metastasis in hepatocellular carcinoma via targeting Pyk2. Biomed Pharmacother. 2017 May;89:642-650.
REF 3 Down-regulation of miR-517a and miR-517c promotes proliferation of hepatocellular carcinoma cells via targeting Pyk2. Cancer Lett. 2013 Feb 28;329(2):164-73.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.