miRNA General Information
miRNA Mature ID hsa-miR-517a-3p
miRNA Stemloop AC MI0003161
miRNA Stemloop ID hsa-mir-517a
Sequence aucgugcaucccuuuagagugu
TTD Target(s) Regulated by This miRNA Focal adhesion kinase 2 (PTK2B) Literature-reported Target Target Info [1]
Protein(s) Regulated by This miRNA TNFAIP3-interacting protein 1 Regulated Protein [2]
References
REF 1 Down-regulation of miR-517a and miR-517c promotes proliferation of hepatocellular carcinoma cells via targeting Pyk2. Cancer Lett. 2013 Feb 28;329(2):164-73.
REF 2 A functional genomics screen for microRNA regulators of NF-kappaB signaling.BMC Biol. 2013 Feb 28;11:19.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.