miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-517c-3p | ||||
miRNA Stemloop AC | MI0003174 | ||||
miRNA Stemloop ID | hsa-mir-517c | ||||
Sequence | aucgugcauccuuuuagagugu | ||||
TTD Target(s) Regulated by This miRNA | Focal adhesion kinase 2 (PTK2B) | Literature-reported Target | Target Info | [1] | |
References | |||||
REF 1 | Down-regulation of miR-517a and miR-517c promotes proliferation of hepatocellular carcinoma cells via targeting Pyk2. Cancer Lett. 2013 Feb 28;329(2):164-73. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.