Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T06841 Target Info
Target Name Interleukin-23 (IL23)
Synonyms UNQ2498/PRO5798; SGRF; P40 subunit of interleukin-23; Interleukin-23 subunit p19; Interleukin-23 subunit alpha; Interleukin 23 subunit alpha; IL-23p19; IL-23-A; IL-23 subunit alpha; IL-23
Target Type Successful Target
Gene Name IL23A
Biochemical Class Cytokine: interleukin
UniProt ID
Q9NPF7
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-10a-5p miRNA Info
miRNA Mature AC
MIMAT0000253
Sequence uacccuguagauccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-10a targets human IL23A and inhibits its expression. [1]
Evidence Score (E-score) 1 +
1 ELISA [1]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
References  Top
REF 1 miR-10a inhibits dendritic cell activation and Th1/Th17 cell immune responses in IBD. Gut. 2015 Nov;64(11):1755-64.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.