Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T04361 Target Info
Target Name TGF-beta-activated kinase 1 (MAP3K7)
Synonyms Transforming growth factor-beta-activated kinase 1; TAK1; Mitogen-activated protein kinase kinase kinase 7
Target Type Literature-reported Target
Gene Name MAP3K7
Biochemical Class Kinase
UniProt ID
O43318
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-10a-5p miRNA Info
miRNA Mature AC
MIMAT0000253
Sequence uacccuguagauccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-10a inhibits MAP3K7 through 3'UTR binding. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-892b miRNA Info
miRNA Mature AC
MIMAT0004918
Sequence cacuggcuccuuucuggguaga
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-892b resulted in the decreased protein level of MAP3K7. [2]
Evidence Score (E-score) 1 +
1 Immunoprecipitation; Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
References  Top
REF 1 MicroRNA-10a regulation of proinflammatory phenotype in athero-susceptible endothelium in vivo and in vitro. Proc Natl Acad Sci U S A. 2010 Jul 27;107(30):13450-5.
REF 2 miR-892b Silencing Activates NF-B and Promotes Aggressiveness in Breast Cancer. Cancer Res. 2016 Mar 1;76(5):1101-11.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.