Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T03687 |
Target Info
|
| Target Name |
Histone deacetylase 9 (HDAC9) |
| Synonyms |
MITR; MEF2-interacting transcription repressor MITR; KIAA0744; Histone deacetylase-related protein; Histone deacetylase 7B; HDRP; HDAC7B; HDAC7; HD9; HD7b |
| Target Type |
Patented-recorded Target |
| Gene Name |
HDAC9 |
| Biochemical Class |
Carbon-nitrogen hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-29a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
acugauuucuuuugguguucag
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
qPCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Dickkopf-related protein 1 (DKK1)
|
Target Info
|
|
|
Glycogen synthase kinase-3 beta (GSK-3B)
|
Target Info
|
|
| References |
Top |
| REF 1 |
TGF-1 Reduces miR-29a Expression to Promote Tumorigenicity and Metastasis of Cholangiocarcinoma by Targeting HDAC4. PLoS One. 2015 Oct 6;10(10):e0136703.
|
| REF 2 |
Class II HDAC inhibition hampers hepatic stellate cell activation by induction of microRNA-29. PLoS One. 2013;8(1):e55786.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
