Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T03573 Target Info
Target Name Immunoglobulin gamma Fc receptor IIB (FCGR2B)
Synonyms Low affinity immunoglobulin gamma Fc region receptor II-b; IgG Fc receptor II-b; FcRII-b; Fc-gamma-RIIb; Fc-gamma RII-b; FCG2B; CDw32 B; CD32 B
Target Type Clinical trial Target
Gene Name FCGR2B
Biochemical Class Immunoglobulin
UniProt ID
P31994
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
MIMAT0000072
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Regulation Mechanism FCGR2B was a direct target of miR-19. [1]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 The Myc-miR-17-92 axis amplifies B-cell receptor signaling via inhibition of ITIM proteins: a novel lymphomagenic feed-forward loop. Blood. 2013 Dec 19;122(26):4220-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.