miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-136-5p | ||||
| miRNA Stemloop AC | MI0000475 | ||||
| miRNA Stemloop ID | hsa-mir-136 | ||||
| Sequence | acuccauuuguuuugaugaugga | ||||
| TTD Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [1] | |
| Interleukin-6 (IL6) | Successful Target | Target Info | [2] | ||
| Metastasis adhesion protein (MTDH) | Literature-reported Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Ras GTPase-activating protein nGAP | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | MiR-136 promotes apoptosis of glioma cells by targeting AEG-1 and Bcl-2. FEBS Lett. 2012 Oct 19;586(20):3608-12. | ||||
| REF 2 | Identification of cellular microRNA-136 as a dual regulator of RIG-I-mediated innate immunity that antagonizes H5N1 IAV replication in A549 cells. Sci Rep. 2015 Oct 9;5:14991. | ||||
| REF 3 | miR-136 suppresses tumor invasion and metastasis by targeting RASAL2 in triple-negative breast cancer.Oncol Rep. 2016 Jul;36(1):65-71. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.