Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T99829 Target Info
Target Name Forkhead box protein C1 (FOXC1)
Synonyms Forkhead-related transcription factor 3; Forkhead-related protein FKHL7; FREAC3; FREAC-3; FKHL7
Target Type Literature-reported Target
Gene Name FOXC1
UniProt ID
Q12948
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 PAR-CLIP [2]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-495-3p miRNA Info
miRNA Mature AC
MIMAT0002817
Sequence aaacaaacauggugcacuucuu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 GFP Reporter Assay; qRT-PCR; Western Blot [3]
2 PAR-CLIP [2]
Representative Target(s) Regulated by This miRNA Endoplasmic reticulum chaperone BiP (HSPA5) Target Info
BIP_HUMAN
Forkhead box protein C1 (FOXC1) Target Info
FOXC1_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism miR-133 can inhibit pituitary adenoma cell migration and invasion through direct targeting and negative control of forkhead box C1 (FOXC1). [4]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot; EGFR Reporter Assay; Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-639 miRNA Info
miRNA Mature AC
MIMAT0003309
Sequence aucgcugcgguugcgagcgcugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Forkhead box protein C1 (FOXC1) Target Info
FOXC1_HUMAN
Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
References  Top
REF 1 Dysregulation of microRNA-204 mediates migration and invasion of endometrial cancer by regulating FOXC1. Int J Cancer. 2012 Mar 1;130(5):1036-45.
REF 2 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 3 MicroRNA-495 downregulates FOXC1 expression to suppress cell growth and migration in endometrial cancer. Tumour Biol. 2016 Jan;37(1):239-51.
REF 4 miR-133 inhibits pituitary tumor cell migration and invasion via down-regulating FOXC1 expression. Genet Mol Res. 2016 Mar 24;15(1). doi: 10.4238/gmr.15017453.
REF 5 miR-639 regulates transforming growth factor beta-induced epithelial-mesenchymal transition in human tongue cancer cells by targeting FOXC1. Cancer Sci. 2014 Oct;105(10):1288-98.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.