Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T99402 |
Target Info
|
| Target Name |
Metabotropic glutamate receptor 4 (mGluR4) |
| Synonyms |
mGluR4; Group III metabotropic glutamate receptor 4; GPRC1D |
| Target Type |
Literature-reported Target |
| Gene Name |
GRM4 |
| Biochemical Class |
GPCR glutamate |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-1202 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
gugccagcugcagugggggag
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-1202 level correlated negatively with the expression of GRM4. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
PCR |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Metabotropic glutamate receptor 4 (mGluR4)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-335-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucaagagcaauaacgaaaaaugu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-335 can directly target GRM4 and suppress its expression. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[3] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
|
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
| References |
Top |
| REF 1 |
A genetic variant in miRNA binding site of glutamate receptor 4, metabotropic (GRM4) is associated with increased risk of major depressive disorder. J Affect Disord. 2017 Jan 15;208:218-222.
|
| REF 2 |
miR-1202 is a primate-specific and brain-enriched microRNA involved in major depression and antidepressant treatment. Nat Med. 2014 Jul;20(7):764-8.
|
| REF 3 |
MiR-335 is involved in major depression disorder and antidepressant treatment through targeting GRM4. Neurosci Lett. 2015 Oct 8;606:167-72.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
