miRNA General Information
miRNA Mature ID	hsa-miR-1202
miRNA Stemloop AC	MI0006334
miRNA Stemloop ID	hsa-mir-1202
Sequence	gugccagcugcagugggggag
TTD Target(s) Regulated by This miRNA	Metabotropic glutamate receptor 4 (mGluR4)	Literature-reported Target	Target Info	[1]
References
REF 1	miR-1202 is a primate-specific and brain-enriched microRNA involved in major depression and antidepressant treatment. Nat Med. 2014 Jul;20(7):764-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.