Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T98798 Target Info
Target Name Sodium/phosphate cotransporter 2B (SLC34A2)
Synonyms Solute carrier family 34 member 2; Sodium-phosphate transport protein 2B; Sodium-dependent phosphate transport protein 2B; NaPi3b; NaPi-2b; Na(+)/Pi cotransporter 2B; Na(+)-dependent phosphate cotransporter 2B
Target Type Clinical trial Target
Gene Name SLC34A2
Biochemical Class Phosphate:sodium symporter
UniProt ID
O95436
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-939-5p miRNA Info
miRNA Mature AC
MIMAT0004982
Sequence uggggagcugaggcucugggggug
miRNA Species Homo sapiens
Regulation Mechanism miR-939 acts as a tumor suppressor miRNA in gastric cancer, and miR-939/SLC34A2 axis represents a novel therapeutic strategy for future gastric cancer treatment. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Sodium/phosphate cotransporter 2B (SLC34A2) Target Info
NPT2B_HUMAN
References  Top
REF 1 Decreased expression of miR-939 contributes to chemoresistance and metastasis of gastric cancer via dysregulation of SLC34A2 and Raf/MEK/ERK pathway. Mol Cancer. 2017 Jan 23;16(1):18.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.