miRNA General Information
miRNA Mature ID	hsa-miR-939-5p
miRNA Stemloop AC	MI0005761
miRNA Stemloop ID	hsa-mir-939
Sequence	uggggagcugaggcucugggggug
TTD Target(s) Regulated by This miRNA	Sodium/phosphate cotransporter 2B (SLC34A2)	Clinical trial Target	Target Info	[1]
References
REF 1	Decreased expression of miR-939 contributes to chemoresistance and metastasis of gastric cancer via dysregulation of SLC34A2 and Raf/MEK/ERK pathway. Mol Cancer. 2017 Jan 23;16(1):18.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.