Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T98635 |
Target Info
|
| Target Name |
Angiopoietin-related protein 4 (ANGPTL4) |
| Synonyms |
UNQ171/PRO197; PSEC0166; PP1158; PGAR; Hepatic fibrinogen/angiopoietin-related protein; HFARP; Angiopoietin-like protein PP1158; Angiopoietin-like protein 4; Angiopoietin-like 4; ARP4 |
| Target Type |
Literature-reported Target |
| Gene Name |
ANGPTL4 |
| Biochemical Class |
Fibrinogen protein |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-134-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugugacugguugaccagagggg
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Luciferase reporter assay revealed that the wild-type 3'UTR of ANGPTL4 exhibited a low translation level in the presence of miR-134, whereas the mutated 3'UTR did not respond to miR-134 suggesting that ANGPTL4 was a specific target of miR-134. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunoblot; Immunoprecipitation; Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Western Blot; Co-Immunoprecipitation |
[2] |
| Representative Target(s) Regulated by This miRNA |
Angiopoietin-related protein 4 (ANGPTL4)
|
Target Info
|
|
|
Erbb2 tyrosine kinase receptor (HER2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-134 actives lipoprotein lipase-mediated lipid accumulation and inflammatory response by targeting angiopoietin-like 4 in THP-1 macrophages. Biochem Biophys Res Commun. 2016 Apr 8;472(3):410-7.
|
| REF 2 |
MicroRNA-134 Promotes the Development of Atherosclerosis Via the ANGPTL4/LPL Pathway in Apolipoprotein E Knockout Mice. J Atheroscler Thromb. 2018 Mar 1;25(3):244-253.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
