Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T98577 |
Target Info
|
| Target Name |
Integrin alpha-11 (ITGA11) |
| Synonyms |
MSTP018 |
| Target Type |
Literature-reported Target |
| Gene Name |
ITGA11 |
| Biochemical Class |
Integrin |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-29a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcaccaucugaaaucgguua
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
ITGA11 is a direct target of miR-29. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunohistochemistry |
[1] |
| 2 |
Luciferase Reporter Assay; Northern Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Aryl hydrocarbon receptor (AHR)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Restoration of miR-29b exerts anti-cancer effects on glioblastoma. Cancer Cell Int. 2017 Nov 17;17:104.
|
| REF 2 |
miR-29 is a major regulator of genes associated with pulmonary fibrosis. Am J Respir Cell Mol Biol. 2011 Aug;45(2):287-94.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
