Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T98293 |
Target Info
|
| Target Name |
PAK-4 protein kinase (PAK4) |
| Synonyms |
p21-activated kinase 4; Serine/threonine-protein kinase PAK 4; PAK-4; KIAA1142 |
| Target Type |
Clinical trial Target |
| Gene Name |
PAK4 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-145-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
guccaguuuucccaggaaucccu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-145 directly targets PAK4 and miR-145 targets a binding site in the 3'UTR of PAK4. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
A proliferation-inducing ligand (APRIL)
|
Target Info
|
|
|
Alkaline phosphatase (ALPPL2)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-199b-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
acaguagucugcacauugguua
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-199b-3p down regulated PAK4 expression in both mRNA and protein levels. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
PAK-4 protein kinase (PAK4)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-145 regulates PAK4 via the MAPK pathway and exhibits an antitumor effect in human colon cells. Biochem Biophys Res Commun. 2012 Oct 26;427(3):444-9.
|
| REF 2 |
MiR-145 inhibits human colorectal cancer cell migration and invasion via PAK4-dependent pathway. Cancer Med. 2017 Jun;6(6):1331-1340.
|
| REF 3 |
MiR-199a/b-3p suppresses migration and invasion of breast cancer cells by downregulating PAK4/MEK/ERK signaling pathway. IUBMB Life. 2015 Oct;67(10):768-77.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
