Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T97903 Target Info
Target Name Histone deacetylase 11 (HDAC11)
Synonyms HD11
Target Type Patented-recorded Target
Gene Name HDAC11
Biochemical Class Carbon-nitrogen hydrolase
UniProt ID
Q96DB2
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 increased IL-10 by targeting HDAC11. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
References  Top
REF 1 Type I IFN inhibits innate IL-10 production in macrophages through histone deacetylase 11 by downregulating microRNA-145. J Immunol. 2013 Oct 1;191(7):3896-904.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.