Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T97174 | Target Info | |||
| Target Name | Mannose-6-phosphate receptor (M6PR) | ||||
| Synonyms | MPRD; MPR46; MPR 46; Cation-dependent mannose-6-phosphate receptor; CDMan-6-P receptor; CD-MPR; CD Man-6-P receptor; 46kDa mannose 6-phosphate receptor; 46 kDa mannose 6-phosphate receptor | ||||
| Target Type | Successful Target | ||||
| Gene Name | M6PR | ||||
| Biochemical Class | Mannose 6-phosphate receptor | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-204-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uucccuuugucauccuaugccu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | M6PR was validated as direct targets of miR-204. Down-regulation of expressions at protein levels of M6PR was confirmed by Western blot. | [2] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Luciferase Reporter Assay | [1] | |||
| 2 | Luciferase Reporter Assay; Western Blot | [2] | |||
| Representative Target(s) Regulated by This miRNA | Alkaline phosphatase tissue-nonspecific (ALPL) | Target Info | |||
| Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
| miRNA Mature ID | hsa-miR-211-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uucccuuugucauccuucgccu | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | M6PR is generally down-regulated by miR-211 indirectly drives the expression of miR-211. | [3] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay; Western Blot | [3] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
| Calcium-activated potassium channel KCa1.1 (KCNMA1) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Downregulation of miR-204 expression defines a highly aggressive subset of Group 3/Group 4 medulloblastomas. Acta Neuropathol Commun. 2019 Apr 3;7(1):52. | ||||
| REF 2 | Role of miR-204 in the regulation of apoptosis, endoplasmic reticulum stress response, and inflammation in human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2011 May 6;52(6):2999-3007. | ||||
| REF 3 | New target genes of MITF-induced microRNA-211 contribute to melanoma cell invasion. PLoS One. 2013 Sep 5;8(9):e73473. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.