Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T96916 Target Info
Target Name Dickkopf-related protein 3 (DKK3)
Synonyms hDkk-3; UNQ258/PRO295; REIC; Dkk-3; Dickkopf-3
Target Type Clinical trial Target
Gene Name DKK3
Biochemical Class Dickkopf protein
UniProt ID
Q9UBP4
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-183-5p miRNA Info
miRNA Mature AC
MIMAT0000261
Sequence uauggcacugguagaauucacu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
Early growth response protein 1 (EGR-1) Target Info
EGR1_HUMAN
miRNA Mature ID hsa-miR-92b-3p miRNA Info
miRNA Mature AC
MIMAT0003218
Sequence uauugcacucgucccggccucc
miRNA Species Homo sapiens
Regulation Mechanism miR-92b reduced the luciferase activity of DKK3-WT but had no effect on DKK3-Mut. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
miRNA Mature ID hsa-miR-582-3p miRNA Info
miRNA Mature AC
MIMAT0004797
Sequence uaacugguugaacaacugaacc
miRNA Species Homo sapiens
Regulation Mechanism miR-582-3p overexpression simultaneously targets multiple negative regulators of the Wnt/b-catenin pathway, namely DKK3. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; RNA Immunopercipitation [4]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
Geranylgeranyl transferase I (GGTase-I) Target Info
PGTB1_HUMAN
References  Top
REF 1 microRNA-183 is an oncogene targeting Dkk-3 and SMAD4 in prostate cancer. Br J Cancer. 2013 Apr 30;108(8):1659-67.
REF 2 MicroRNA-183 promotes the proliferation and metastasis of renal cell carcinoma through targeting Dickkopf-related protein 3. Oncol Lett. 2018 Apr;15(4):6003-6008.
REF 3 MiR-92b inhibitor promoted glioma cell apoptosis via targeting DKK3 and blocking the Wnt/beta-catenin signaling pathway. J Transl Med. 2013 Dec 11;11:302.
REF 4 Aberrantly expressed miR-582-3p maintains lung cancer stem cell-like traits by activating Wnt/-catenin signalling. Nat Commun. 2015 Oct 15;6:8640.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.