Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T96894 Target Info
Target Name Leukemia inhibitory factor receptor (LIFR)
Synonyms LIF-R; LIF receptor; CD118
Target Type Clinical trial Target
Gene Name LIFR
Biochemical Class Cytokine receptor
UniProt ID
P42702
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism LIFR protein expression in miR-125a overexpressing MCF12A cells showed the opposite trend of decreased LIFR protein expression providing further evidence that miR-125a regulated the expression of LIFR. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism Co-expression of miR-203 with either reporter gene resulted in decreased luciferase activities. In contrast, when we deleted the miR-203-binding sites in both reporter genes, miR-203 was much less effective in repressing the activity of the mutant reporter genes. [3]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
References  Top
REF 1 MicroRNA-125a influences breast cancer stem cells by targeting leukemia inhibitory factor receptor which regulates the Hippo signaling pathway. Oncotarget. 2015 Jul 10;6(19):17366-78.
REF 2 Two common SNPs in pri-miR-125a alter the mature miRNA expression and associate with recurrent pregnancy loss in a Han-Chinese population. RNA Biol. 2011 Sep-Oct;8(5):861-72.
REF 3 miR-203, a tumor suppressor frequently down-regulated by promoter hypermethylation in rhabdomyosarcoma. J Biol Chem. 2014 Jan 3;289(1):529-39.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.