Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T96669 | Target Info | |||
| Target Name | Clusterin (CLU) | ||||
| Synonyms | Testosteronerepressed prostate message 2; Testosterone-repressed prostate message 2; TRPM-2; NA1/NA2; Ku70binding protein 1; Ku70-binding protein 1; KUB1; Complementassociated protein SP40,40; Complement-associated protein SP-40,40; Complement cytolysis inhibitor; Clusterin alpha chain; CLI; Apolipoprotein J; ApoJ; Apo-J; Agingassociated gene 4 protein; Aging-associated gene 4 protein; AAG4 | ||||
| Target Type | Literature-reported Target | ||||
| Gene Name | CLU | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-17-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | caaagugcuuacagugcagguag | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | The repression of miR-17 influences cell death upon DNA damage and mediates regulation of CLU in colon cancer cells. | [1] | |||
| Evidence Score (E-score) | 2 | + | |||
| 1 | Immunohistochemistry; Western Blot | [1] | |||
| 2 | Western Blot; Luciferase Reporter Assay | [2] | |||
| Representative Target(s) Regulated by This miRNA | Amyloid beta A4 protein (APP) | Target Info | |||
| Apoptosis mediating surface antigen FAS (FAS) | Target Info | ||||
| miRNA Mature ID | hsa-miR-21-5p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | uagcuuaucagacugauguuga | ||||
| miRNA Species | Homo sapiens | ||||
| Regulation Mechanism | CLU is a gene-specific target of miRNA-21. | [3] | |||
| Evidence Score (E-score) | 1 | + | |||
| 1 | Luciferase Reporter Assay | [3] | |||
| Representative Target(s) Regulated by This miRNA | Apoptosis antigen ligand (CD178) | Target Info | |||
| Apoptosis regulator Bcl-2 (BCL-2) | Target Info | ||||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | Estrogen receptor expression induces changes in the microRNA pool in human colon cancer cells. Carcinogenesis. 2013 Jul;34(7):1431-41. | ||||
| REF 2 | The myc-miR-17~92 axis blunts TGF{beta} signaling and production of multiple TGF{beta}-dependent antiangiogenic factors. Cancer Res. 2010 Oct 15;70(20):8233-46. | ||||
| REF 3 | Clusterin is a gene-specific target of microRNA-21 in head and neck squamous cell carcinoma. Clin Cancer Res. 2014 Feb 15;20(4):868-77. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.