Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T93450 Target Info
Target Name Interleukin-24 (IL24)
Synonyms Suppression of tumorigenicity 16 protein; ST16; Melanoma differentiationassociated gene 7 protein; Melanoma differentiation-associated gene 7 protein; MDA7; MDA-7; Interleukin24; IL-24
Target Type Clinical trial Target
Gene Name IL24
Biochemical Class Cytokine: interleukin
UniProt ID
Q13007
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Regulation Mechanism miR-205 acts as tumor suppressor miRNA by directly targeting the tumor suppressor genes IL24 through apoptotic and cell-survival pathways in Pca. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
References  Top
REF 1 MicroRNA-205 directly regulates the tumor suppressor, interleukin-24, in human KB oral cancer cells. Mol Cells. 2013 Jan;35(1):17-24.
REF 2 MicroRNA-205-directed transcriptional activation of tumor suppressor genes in prostate cancer. Cancer. 2010 Dec 15;116(24):5637-49.
REF 3 Regulation of pro-inflammatory cytokines TNF and IL24 by microRNA-203 in primary keratinocytes. Cytokine. 2012 Dec;60(3):741-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.