Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T92640 Target Info
Target Name Lysophosphatidic acid receptor 1 (LPAR1)
Synonyms Lysophosphatidic acid receptor Edg-2; LPA1; LPA-1; LPA receptor 1; EDG2; EDG 2 receptor
Target Type Clinical trial Target
Gene Name LPAR1
Biochemical Class GPCR rhodopsin
UniProt ID
Q92633
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism LPAR1 is a target of miR-200c. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-23a significantly attenuated the protein levels of LPAR1. And miR-23a knockdown with miR-23a inhibitor increased the levels of LPAR1 proteins. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-338-5p miRNA Info
miRNA Mature AC
MIMAT0004701
Sequence aacaauauccuggugcugagug
miRNA Species Homo sapiens
Regulation Mechanism LPA1 is the downstream target of miR-338. [3]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [3]
Representative Target(s) Regulated by This miRNA LDL receptor related protein-1 (LRP-1) Target Info
LRP1_HUMAN
Lysophosphatidic acid receptor 1 (LPAR1) Target Info
LPAR1_HUMAN
References  Top
REF 1 Regulation of trabecular meshwork cell contraction and intraocular pressure by miR-200c. PLoS One. 2012;7(12):e51688.
REF 2 Reciprocal regulation of miR-23a and lysophosphatidic acid receptor signaling in cardiomyocyte hypertrophy. Biochim Biophys Acta. 2013 Aug;1831(8):1386-94.
REF 3 MiR-338* suppresses fibrotic pathogenesis in pulmonary fibrosis through targeting LPA1. Am J Transl Res. 2016 Jul 15;8(7):3197-205.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.