Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T92635 |
Target Info
|
| Target Name |
GATA-binding factor 3 (GATA3) |
| Synonyms |
Trans-acting T-cell-specific transcription factor GATA-3 |
| Target Type |
Literature-reported Target |
| Gene Name |
GATA3 |
| Biochemical Class |
Zinc-finger |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-27a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uucacaguggcuaaguuccgc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-27 regulate Th2 differentiation and function through targeting GATA3. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter A1 (ABCA1)
|
Target Info
|
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-23 7 4 clusters control effector T cell differentiation and function. J Exp Med. 2016 Feb 8;213(2):235-49.
|
| REF 2 |
MicroRNAs 24 and 27 Suppress Allergic Inflammation and Target a Network of Regulators of T Helper 2 Cell-Associated Cytokine Production. Immunity. 2016 Apr 19;44(4):821-32.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
