Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T90572 Target Info
Target Name Insulin-like growth factor-II (IGF2)
Synonyms T3M-11-derived growth factor; Somatomedin-A; Somatomedin A; PP1446; Insulin-like growth factor II; Insulin-like growth factor 2; IGF-II
Target Type Clinical trial Target
Gene Name IGF2
UniProt ID
P01344
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-615-5p miRNA Info
miRNA Mature AC
MIMAT0004804
Sequence ggggguccccggugcucggauc
miRNA Species Homo sapiens
Regulation Mechanism IGF-II is a direct target of miR-615-5p. [2]
Evidence Score (E-score) 2 +
1 ELISA; Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Insulin-like growth factor-II (IGF2) Target Info
IGF2_HUMAN
miRNA Mature ID hsa-miR-100-5p miRNA Info
miRNA Mature AC
MIMAT0000098
Sequence aacccguagauccgaacuugug
miRNA Species Homo sapiens
Regulation Mechanism Loss of miR-100 enhances IGF2 levels in mammary tumor cells. [3]
Evidence Score (E-score) 1 +
1 Northern Blot; Western Blot; Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-150-5p miRNA Info
miRNA Mature AC
MIMAT0000451
Sequence ucucccaacccuuguaccagug
miRNA Species Homo sapiens
Regulation Mechanism miR-125b is a bona fide Igf2 regulator. [4]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [4]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Beta-arrestin-2 (ARRB2) Target Info
ARRB2_HUMAN
miRNA Mature ID hsa-miR-663b miRNA Info
miRNA Mature AC
MIMAT0005867
Sequence gguggcccggccgugccugagg
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-663b markedly inhibited the luciferase activity in the WT 3'UTR of IGF2, while luciferase activity was not affected by miR-663b mimics transfection in cells with MUT IGF2 3'UTR reporter. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Insulin-like growth factor-II (IGF2) Target Info
IGF2_HUMAN
References  Top
REF 1 miR-615-5p is epigenetically inactivated and functions as a tumor suppressor in pancreatic ductal adenocarcinoma. Oncogene. 2015 Mar 26;34(13):1629-40.
REF 2 miR-615-5p is restrictedly expressed in cirrhotic and cancerous liver tissues and its overexpression alleviates the tumorigenic effects in hepatocellular carcinoma. FEBS Lett. 2012 Sep 21;586(19):3309-16.
REF 3 miR-100 suppresses IGF2 and inhibits breast tumorigenesis by interfering with proliferation and survival signaling. Oncogene. 2013 Jul 4;32(27):3306-10.
REF 4 IGF-II is regulated by microRNA-125b in skeletal myogenesis. J Cell Biol. 2011 Jan 10;192(1):69-81.
REF 5 Epigenetic inhibition of miR-663b by long non-coding RNA HOTAIR promotes pancreatic cancer cell proliferation via up-regulation of insulin-like growth factor 2. Oncotarget. 2016 Dec 27;7(52):86857-86870.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.