miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-615-5p | ||||
| miRNA Stemloop AC | MI0003628 | ||||
| miRNA Stemloop ID | hsa-mir-615 | ||||
| Sequence | ggggguccccggugcucggauc | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor-II (IGF2) | Clinical trial Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Ras-related protein Rab-24 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | miR-615-5p is restrictedly expressed in cirrhotic and cancerous liver tissues and its overexpression alleviates the tumorigenic effects in hepatocellular carcinoma. FEBS Lett. 2012 Sep 21;586(19):3309-16. | ||||
| REF 2 | KDM4B-mediated epigenetic silencing of miRNA-615-5p augments RAB24 to facilitate malignancy of hepatoma cells.Oncotarget. 2017 Mar 14;8(11):17712-17725. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.