Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T90071 |
Target Info
|
| Target Name |
Myosin-2 (MYH2) |
| Synonyms |
Myosin heavy chain, skeletal muscle, adult 2; Myosin heavy chain IIa; Myosin heavy chain 2a; Myosin heavy chain 2; MyHCIIa; MyHC2a; MyHC-IIa; MyHC-2a; MYHSA2 |
| Target Type |
Literature-reported Target |
| Gene Name |
MYH2 |
| Biochemical Class |
Myosin-kinesin ATPase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-23a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aucacauugccagggauuucc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-23a directly targets the 3'UTR of MYH2. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Western Blot; RT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
|
DNA topoisomerase I (TOP1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-494-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugaaacauacacgggaaaccuc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
MYH2 is a downstream target of miR-494. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
qRT-PCR; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiR-23a inhibits myogenic differentiation through down regulation of fast myosin heavy chain isoforms. Exp Cell Res. 2012 Nov 1;318(18):2324-34.
|
| REF 2 |
Loss of microRNA-23-27-24 clusters in skeletal muscle is not influential in skeletal muscle development and exercise-induced muscle adaptation. Sci Rep. 2019 Jan 31;9(1):1092.
|
| REF 3 |
MicroRNA-494 plays a role in fiber type-specific skeletal myogenesis in human induced pluripotent stem cells. Biochem Biophys Res Commun. 2015 Dec 4-11;468(1-2):208-13.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
