Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T87749 |
Target Info
|
| Target Name |
Growth/differentiation factor 8 (GDF-8) |
| Synonyms |
GDF8 |
| Target Type |
Clinical trial Target |
| Gene Name |
MSTN |
| Biochemical Class |
Growth factor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-208b-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aagcuuuuugcucgaauuaugu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
qRT-PCR |
[1] |
| 2 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
Growth/differentiation factor 8 (GDF-8)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA-208b progressively declines after spinal cord injury in humans and is inversely related to myostatin expression. Physiol Rep. 2015 Nov;3(11). pii: e12622.
|
| REF 2 |
Myostatin and IGF-I signaling in end-stage human heart failure: a qRT-PCR study. J Transl Med. 2015 Jan 16;13:1.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
