miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-208b-5p | ||||
miRNA Stemloop AC | MI0005570 | ||||
miRNA Stemloop ID | hsa-mir-208b | ||||
Sequence | aagcuuuuugcucgaauuaugu | ||||
TTD Target(s) Regulated by This miRNA | Growth/differentiation factor 8 (GDF-8) | Clinical trial Target | Target Info | [1] | |
References | |||||
REF 1 | MicroRNA-208b progressively declines after spinal cord injury in humans and is inversely related to myostatin expression. Physiol Rep. 2015 Nov;3(11). pii: e12622. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.