The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-296-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agggcccccccucaauccugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-296 is a critical upstream regulator of S100B. |
[1] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-29a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcaccaucugaaaucgguua
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The cellular miRNA hsa-miR29a downregulates the expression of S100B protein. |
[2] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Northern Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Aryl hydrocarbon receptor (AHR)
|
Target Info
|
|