Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T87108 Target Info
Target Name Mesothelin (MSLN)
Synonyms Prepromegakaryocytepotentiating factor; Pre-pro-megakaryocyte-potentiating factor; Mesothelin, cleaved form; MPF; CAK1 antigen
Target Type Clinical trial Target
Gene Name MSLN
UniProt ID
Q13421
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism Direct interaction between miR-21-5p and MSLN is confirmed by luciferase assay in Mero-14 cells. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 Identification of MiR-21-5p as a Functional Regulator of Mesothelin Expression Using MicroRNA Capture Affinity Coupled with Next Generation Sequencing. PLoS One. 2017 Jan 26;12(1):e0170999.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.