Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T87020 |
Target Info
|
| Target Name |
FK506-binding protein 4 (FKBP4) |
| Synonyms |
p59; Peptidyl-prolyl cis-trans isomerase FKBP4; PPIase FKBP4; P59 protein; Immunophilin FKBP52; HSP-binding immunophilin; HSP binding immunophilin; HBI; FKBP59; FKBP52 protein; FKBP52; FKBP-52; FKBP-4; 59 kDa immunophilin; 52 kDa FKBP; 52 kDa FK506-binding protein; 52 kDa FK506 binding protein |
| Target Type |
Literature-reported Target |
| Gene Name |
FKBP4 |
| Biochemical Class |
Cis-trans-isomerase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-328-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cuggcccucucugcccuuccgu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The miR-328 target FKBP4, a cochaperone that regulates cellular transport and is part of steroid receptor complexes, was up-regulated in senescent PLTs. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Microarray; Next Generation Sequencing |
[1] |
| Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
|
Beta-secretase 1 (BACE1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Transcriptomic profiling of platelet senescence and platelet extracellular vesicles. Transfusion. 2017 Jan;57(1):144-156.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
