Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T85529 Target Info
Target Name T-cell-specific surface glycoprotein CD28 (CD28)
Synonyms TP44; CD28-S2
Target Type Successful Target
Gene Name CD28
UniProt ID
P10747
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 targets CD28. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
References  Top
REF 1 Identification of novel MicroRNA signatures linked to experimental autoimmune myasthenia gravis pathogenesis: down-regulated miR-145 promotes pathogenetic Th17 cell response. J Neuroimmune Pharmacol. 2013 Dec;8(5):1287-302.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.