Target Regulator(s) Information (MicroRNA)
| Target General Information | Top | ||||
|---|---|---|---|---|---|
| Target ID | T85523 | Target Info | |||
| Target Name | Cardiac myosin (MYBPC3) | ||||
| Synonyms | Myosinbinding protein C, cardiactype; Myosin-binding protein C, cardiac-type; Cprotein, cardiac muscle isoform; Cardiac MyBPC; Cardiac MyBP-C; C-protein, cardiac muscle isoform | ||||
| Target Type | Clinical trial Target | ||||
| Gene Name | MYBPC3 | ||||
| Biochemical Class | Immunoglobulin | ||||
| UniProt ID | |||||
| The microRNAs (miRNAs) Regulating This Target | Top | ||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-let-7g-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | cuguacaggccacugccuugc | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 1 | + | |||
| 1 | qRT-PCR | [1] | |||
| Representative Target(s) Regulated by This miRNA | Cardiac myosin (MYBPC3) | Target Info | |||
| Monocyte chemotactic and activating factor (CCL2) | Target Info | ||||
| miRNA Mature ID | hsa-let-7f-1-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | cuauacaaucuauugccuuccc | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 1 | + | |||
| 1 | qRT-PCR | [1] | |||
| Representative Target(s) Regulated by This miRNA | Cardiac myosin (MYBPC3) | Target Info | |||
| miRNA Mature ID | hsa-let-7i-3p | miRNA Info | |||
| miRNA Mature AC | |||||
| Sequence | cugcgcaagcuacugccuugcu | ||||
| miRNA Species | Homo sapiens | ||||
| Evidence Score (E-score) | 1 | + | |||
| 1 | qRT-PCR | [1] | |||
| Representative Target(s) Regulated by This miRNA | Cardiac myosin (MYBPC3) | Target Info | |||
| References | Top | ||||
|---|---|---|---|---|---|
| REF 1 | H-ferritin-regulated microRNAs modulate gene expression in K562 cells. PLoS One. 2015 Mar 27;10(3):e0122105. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.