miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-let-7f-1-3p | ||||
miRNA Stemloop AC | MI0000067 | ||||
miRNA Stemloop ID | hsa-let-7f-1 | ||||
Sequence | cuauacaaucuauugccuuccc | ||||
TTD Target(s) Regulated by This miRNA | Cardiac myosin (MYBPC3) | Clinical trial Target | Target Info | [1] | |
References | |||||
REF 1 | H-ferritin-regulated microRNAs modulate gene expression in K562 cells. PLoS One. 2015 Mar 27;10(3):e0122105. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.