Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T84941 |
Target Info
|
| Target Name |
Eukaryotic translation initiation factor 4E-binding protein 1 (EIF4EBP1) |
| Synonyms |
eIF4E-binding protein 1; Phosphorylated heat- andacid-stable protein regulated by insulin 1; Phosphorylated heat- and acid-stable protein regulated by insulin 1; PHAS-I; 4E-BP1 |
| Target Type |
Literature-reported Target |
| Gene Name |
EIF4EBP1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-125a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucccugagacccuuuaaccuguga
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Transfection of the plasmid containing the wild-type UTR plus a miR-125a mimic resulted in a significant decrease in relative luciferase activity. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
Sequencing |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator BAK (BAK)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNAs 125a and 125b inhibit ovarian cancer cells through post-transcriptional inactivation of EIF4EBP1. Oncotarget. 2016 Feb 23;7(8):8726-42.
|
| REF 2 |
Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
