Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T84780 |
Target Info
|
| Target Name |
Cellular inhibitor of apoptosis 1 (BIRC2) |
| Synonyms |
hIAP2; hIAP-2; TNFR2TRAFsignaling complex protein 2; TNFR2-TRAF-signaling complex protein 2; RNF48; RING-type E3 ubiquitin transferase BIRC2; RING finger protein 48; MIHB; Inhibitor of apoptosis protein 2; IAP2; IAP homolog B; CIAP1; C-IAP1; Baculoviral IAP repeatcontaining protein 2; Baculoviral IAP repeat-containing protein 2; API1 |
| Target Type |
Clinical trial Target |
| Gene Name |
BIRC2 |
| Biochemical Class |
Acyltransferase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-204-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uucccuuugucauccuaugccu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
BIRC2 was validated as direct targets of miR-204. Down-regulation of expressions at protein levels of BIRC2 was confirmed by Western blot. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Alkaline phosphatase tissue-nonspecific (ALPL)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Role of miR-204 in the regulation of apoptosis, endoplasmic reticulum stress response, and inflammation in human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2011 May 6;52(6):2999-3007.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
