Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T84703 Target Info
Target Name BDNF/NT-3 growth factors receptor (TrkB)
Synonyms Tropomyosin-related kinase B; TrkB tyrosine kinase; Trk-B; TRKB; Neurotrophic tyrosine kinase receptor type 2; GP145-TrkB
Target Type Successful Target
Gene Name NTRK2
Biochemical Class Kinase
UniProt ID
Q16620
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunoblot; Immunofluorescence; qRT-PCR [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism miR-204 targets TrkB in neuroblastoma celllines. [4]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
2 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism NTRK2 is an oncogene and reversely associated with miR-22 in regulating in vitro cancer development in gastric cancer. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
References  Top
REF 1 miR-200c sensitizes breast cancer cells to doxorubicin treatment by decreasing TrkB and Bmi1 expression. PLoS One. 2012;7(11):e50469.
REF 2 Targets of miR-200c mediate suppression of cell motility and anoikis resistance. Breast Cancer Res. 2011 Apr 18;13(2):R45.
REF 3 A TrkB-STAT3-miR-204-5p regulatory circuitry controls proliferation and invasion of endometrial carcinoma cells. Mol Cancer. 2013 Dec 9;12:155.
REF 4 MicroRNA-204 increases sensitivity of neuroblastoma cells to cisplatin and is associated with a favourable clinical outcome. Br J Cancer. 2012 Sep 4;107(6):967-76.
REF 5 NTRK2 is an oncogene and associated with microRNA-22 regulation in human gastric cancer cell lines. Tumour Biol. 2016 Nov;37(11):15115-15123.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.