Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T84671 Target Info
Target Name T-cell leukemia/lymphoma protein 1A (TCL1A)
Synonyms TCL1 oncogene; TCL1; TCL-1 protein; T-cell leukemia/lymphoma 1 oncogene; Protein p14 TCL1; P14 TCL1 protein; Oncogene TCL1; Oncogene TCL-1
Target Type Literature-reported Target
Gene Name TCL1A
UniProt ID
P56279
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-29b-3p miRNA Info
miRNA Mature AC
MIMAT0000100
Sequence uagcaccauuugaaaucaguguu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-29b-3p by mature miRNA transfection resulted in the decreased protein level of target TCL1A. [1]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-181b-5p miRNA Info
miRNA Mature AC
MIMAT0000257
Sequence aacauucauugcugucggugggu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-181b-5p by mature miRNA transfection resulted in the decreased protein level of target TCL1A. [1]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Estrogen receptor (ESR) Target Info
ESR1_HUMAN
Glutamate receptor AMPA 2 (GRIA2) Target Info
GRIA2_HUMAN
References  Top
REF 1 Tcl1 expression in chronic lymphocytic leukemia is regulated by miR-29 and miR-181. Cancer Res. 2006 Dec 15;66(24):11590-3.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.