miRNA General Information
miRNA Mature ID	hsa-miR-181b-5p
miRNA Stemloop AC	MI0000270 | MI0000683
miRNA Stemloop ID	hsa-mir-181b-1 | hsa-mir-181b-2
Sequence	aacauucauugcugucggugggu
TTD Target(s) Regulated by This miRNA	Estrogen receptor (ESR)	Successful Target	Target Info	[1]
	Glutamate receptor AMPA 2 (GRIA2)	Successful Target	Target Info	[2]
	T-cell leukemia/lymphoma protein 1A (TCL1A)	Literature-reported Target	Target Info	[3]
Protein(s) Regulated by This miRNA	Adenylate cyclase type 9	Regulated Protein	ADCY9_HUMAN	[4]
	Bcl-2-like protein 11	Regulated Protein	B2L11_HUMAN	[5]
	Caspase recruitment domain-containing protein 10	Regulated Protein	CAR10_HUMAN	[6]
	E3 ubiquitin-protein ligase RING2	Regulated Protein	RING2_HUMAN	[7]
	Elastin	Regulated Protein	ELN_HUMAN	[8]
	Hexokinase-2	Regulated Protein	HXK2_HUMAN	[9]
	Homeobox protein CDX-2	Regulated Protein	CDX2_HUMAN	[10]
	Homeobox protein SIX2	Regulated Protein	SIX2_HUMAN	[11]
	Importin subunit alpha-3	Regulated Protein	IMA3_HUMAN	[12]
	Metalloproteinase inhibitor 3	Regulated Protein	TIMP3_HUMAN	[13]
	Nuclear factor 1 A-type	Regulated Protein	NFIA_HUMAN	[14]
	Pre-B-cell leukemia transcription factor 3	Regulated Protein	PBX3_HUMAN	[15]
	Programmed cell death protein 10	Regulated Protein	PDC10_HUMAN	[16]
	Programmed cell death protein 4	Regulated Protein	PDCD4_HUMAN	[17]
	Ras association domain-containing protein 1	Regulated Protein	RASF1_HUMAN	[18]
	Ras-related protein Rap-1b	Regulated Protein	RAP1B_HUMAN	[19]
	Serine/threonine-protein kinase NLK	Regulated Protein	NLK_HUMAN	[10]
	Transcription factor GATA-6	Regulated Protein	GATA6_HUMAN	[10]
	Transcription factor GATA-6	Regulated Protein	GATA6_HUMAN	[16]
	Transmembrane emp24 domain-containing protein 7	Regulated Protein	TMED7_HUMAN	[20]
	Ubiquitin carboxyl-terminal hydrolase CYLD	Regulated Protein	CYLD_HUMAN	[21]
	Ubiquitin carboxyl-terminal hydrolase CYLD	Regulated Protein	CYLD_HUMAN	[22]
	Visinin-like protein 1	Regulated Protein	VISL1_HUMAN	[2]
	Zinc finger protein PLAG1	Regulated Protein	PLAG1_HUMAN	[24]
References
REF 1	The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47.
REF 2	Dysregulation of miRNA 181b in the temporal cortex in schizophrenia. Hum Mol Genet. 2008 Apr 15;17(8):1156-68.
REF 3	Tcl1 expression in chronic lymphocytic leukemia is regulated by miR-29 and miR-181. Cancer Res. 2006 Dec 15;66(24):11590-3.
REF 4	miR-181b promotes cell proliferation and reduces apoptosis by repressing the expression of adenylyl cyclase 9 (AC9) in cervical cancer cells.FEBS Lett. 2014 Jan 3;588(1):124-30.
REF 5	MiR-181b promotes chemoresistance in breast cancer by regulating Bim expression.Oncol Rep. 2016 Feb;35(2):683-90.
REF 6	MicroRNA-181b inhibits thrombin-mediated endothelial activation and arterial thrombosis by targeting caspase recruitment domain family member 10.FASEB J. 2016 Sep;30(9):3216-26.
REF 7	Coordinated regulation of polycomb group complexes through microRNAs in cancer. Cancer Cell. 2011 Aug 16;20(2):187-99.
REF 8	MicroRNA-181b Controls Atherosclerosis and Aneurysms Through Regulation of TIMP-3 and Elastin.Circ Res. 2017 Jan 6;120(1):49-65.
REF 9	Involvement of EZH2 in aerobic glycolysis of prostate cancer through miR-181b/HK2 axis.Oncol Rep. 2017 Mar;37(3):1430-1436.
REF 10	Identification of microRNA-181 by genome-wide screening as a critical player in EpCAM-positive hepatic cancer stem cells.Hepatology. 2009 Aug;50(2):472-80.
REF 11	MiR-181b targets Six2 and inhibits the proliferation of metanephric mesenchymal cells in vitro.Biochem Biophys Res Commun. 2013 Nov 1;440(4):495-501.
REF 12	Upregulation of miR-181s reverses mesenchymal transition by targeting KPNA4 in glioblastoma.Sci Rep. 2015 Aug 18;5:13072.
REF 13	TGFbeta-mediated upregulation of hepatic miR-181b promotes hepatocarcinogenesis by targeting TIMP3.Oncogene. 2010 Mar 25;29(12):1787-97.
REF 14	MicroRNA 21 (miR-21) and miR-181b couple with NFI-A to generate myeloid-derived suppressor cells and promote immunosuppression in late sepsis.Infect Immun. 2014 Sep;82(9):3816-25.
REF 15	Up-regulation of a HOXA-PBX3 homeobox-gene signature following down-regulation of miR-181 is associated with adverse prognosis in patients with cytogenetically abnormal AML.Blood. 2012 Mar 8;119(10):2314-24.
REF 16	MicroRNA Stability in Postmortem FFPE Tissues: Quantitative Analysis Using Autoptic Samples from Acute Myocardial Infarction Patients.PLoS One. 2015 Jun 5;10(6):e0129338.
REF 17	miR-181b functions as an oncomiR in colorectal cancer by targeting PDCD4. Protein Cell. 2016 Oct;7(10):722-734.
REF 18	PML/RAR-Regulated miR-181a/b Cluster Targets the Tumor Suppressor RASSF1A in Acute Promyelocytic Leukemia.Cancer Res. 2015 Aug 15;75(16):3411-24.
REF 19	miR-181 subunits enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeleton remodeling in glioblastoma cells.Med Oncol. 2014 Apr;31(4):892.
REF 20	miR-181b promotes hepatic stellate cells proliferation by targeting p27 and is elevated in the serum of cirrhosis patients.Biochem Biophys Res Commun. 2012 Apr 27;421(1):4-8.
REF 21	STAT3 activation of miR-21 and miR-181b-1 via PTEN and CYLD are part of the epigenetic switch linking inflammation to cancer. Mol Cell. 2010 Aug 27;39(4):493-506.
REF 22	Reciprocal activation between STAT3 and miR-181b regulates the proliferation of esophageal cancer stem-like cells via the CYLD pathway.Mol Cancer. 2016 May 17;15(1):40.
REF 23	Dysregulation of miRNA 181b in the temporal cortex in schizophrenia. Hum Mol Genet. 2008 Apr 15;17(8):1156-68.
REF 24	miRNA deregulation by epigenetic silencing disrupts suppression of the oncogene PLAG1 in chronic lymphocytic leukemia.Blood. 2009 Oct 8;114(15):3255-64.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.