Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T82955 Target Info
Target Name Ras-related protein Rab-22A (Rab22a)
Synonyms Rab-22; RAB22
Target Type Literature-reported Target
Gene Name RAB22A
Biochemical Class Small GTPase
UniProt ID
Q9UL26
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Immunofluorescence; Microarray; qRT-PCR; Western Blot [1]
2 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay [3]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-211-5p miRNA Info
miRNA Mature AC
MIMAT0000268
Sequence uucccuuugucauccuucgccu
miRNA Species Homo sapiens
Regulation Mechanism The expression of miR-211 target RAB22A was significantly increased only in cells co-transfected with both anti-miR-204 and -211. [1]
Evidence Score (E-score) 2 +
1 Immunofluorescence; Western Blot [1]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Calcium-activated potassium channel KCa1.1 (KCNMA1) Target Info
KCMA1_HUMAN
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-203 reduced RAB22A mRNA and protein expression. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [5]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
References  Top
REF 1 Microphthalmia-associated transcription factor (MITF) promotes differentiation of human retinal pigment epithelium (RPE) by regulating microRNAs-204/211 expression. J Biol Chem. 2012 Jun 8;287(24):20491-503.
REF 2 MicroRNA-204-5p inhibits gastric cancer cell proliferation by downregulating USP47 and RAB22A. Med Oncol. 2015 Jan;32(1):331.
REF 3 Role of miR-204 in the regulation of apoptosis, endoplasmic reticulum stress response, and inflammation in human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2011 May 6;52(6):2999-3007.
REF 4 New target genes of MITF-induced microRNA-211 contribute to melanoma cell invasion. PLoS One. 2013 Sep 5;8(9):e73473.
REF 5 miR-203 Acts as a Tumor Suppressor Gene in Osteosarcoma by Regulating RAB22A. PLoS One. 2015 Sep 18;10(9):e0132225.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.